A HOX gene mutation in a family with isolated congenital vertical talus and Charcot-Marie-Tooth disease

Antony E Shrimpton, E Mark Levinsohn, Justin M Yozawitz, David S Packard Jr, Robert B Cady, Frank A Middleton, Antonio M Persico, David R Hootnick, Antony E Shrimpton, E Mark Levinsohn, Justin M Yozawitz, David S Packard Jr, Robert B Cady, Frank A Middleton, Antonio M Persico, David R Hootnick

Abstract

Congenital vertical talus (CVT), also known as "rocker-bottom foot" deformity, is a dislocation of the talonavicular joint, with rigid dorsal dislocation of the navicular over the neck of the talus. This condition is usually associated with multiple other congenital deformities and only rarely is an isolated deformity. The reported familial cases are consistent with an autosomal dominant mode of inheritance with incomplete penetrance. In contrast, Charcot-Marie-Tooth disease (CMT) is thought to be a completely distinct heterogeneous group of disorders, with foot abnormalities that typically develop a high-arched "claw foot" appearance later in life. In the present study, DNA was isolated from 36 members of a single upstate (northern) New York white family of Italian descent in which both CVT and CMT were segregating. Whole-genome linkage analysis with Affymetrix GeneChip Mapping 10K Array defined a 7-Mb critical region on chromosome 2q31, which led to candidate-gene sequencing of six HOX genes and detection of a single missense mutation, M319K (956T-->A), in the HOXD10 gene. In the study family, this mutation was fully penetrant and exhibited significant evidence of linkage (LOD 6.33; theta =0), and it very likely accounts for both CVT and CMT in heterozygotes.

Figures

Figure A1
Figure A1
Whole-genome haplotype–based parametric linkage map at LOD>1.88
Figure 1
Figure 1
A, Pedigree showing individuals from whom DNA was isolated (bars below symbol). Individuals marked with an asterisk (*) were included in the original 10K Array linkage study. The bars represent the 2q31 chromosomal section between markers D2S124 and D2S1391. B, Critical-region haplotypes in affected individuals, in more detail. All 16 affected individuals—but no unaffected individuals—contain the same chromosomal section distal to D2S1267 and proximal to D2S2978 (boxed). V=CVT; M=CMT; B=CVT and CMT; N=unaffected. An asterisk (*) indicates a presumed 5–6 reversion mutation.
Figure 2
Figure 2
Radiographs of individual V:2 at age 9 years. Despite casting for CVT at age 6 mo, the left foot still shows CVT (A), and the right foot shows a high arch (arrow) and claw toes typical of CMT (B). n=navicular; T=talus; c=calcaneus. Adapted from E.M.L., A.E.S., D.S.P., R.B.C., and D.R.H. (unpublished data).
Figure 3
Figure 3
A, Electropherogram showing M319K mutation sequence. B, NlaIII digested 181-bp products, run on a 2% agarose gel from a subset of affected and unaffected family members. Since the HOXD10 M319K mutation does not alter a naturally occurring restriction enzyme recognition site, a primer (TCAAGATTTGGTTTCAAAACCGCCGC*A) was designed that would create an NlaIII site in combination with wild-type sequence but not with the M319K mutation.

Source: PubMed

3
購読する