Regulation of brain-derived neurotrophic factor expression in neurons

Abstract

Brain-derived neurotrophic factor (BDNF) plays critical roles in many aspects of brain functions, including cell survival, differentiation, development, learning and memory. Aberrant BDNF expression has also been implicated in numerous neurological disorders. Thus, significant effort has been made to understand how BDNF transcription as well as translation is regulated. Interestingly, the BDNF gene structure suggests that multiple promoters control its transcription, leading to the existence of distinct mRNA species. Further, the long- and short-tail of the 3'un-translated region may dictate different sub-cellular BDNF mRNA targeting and translational responses following neuronal stimulation. This review aims to summarize the main findings that demonstrate how neuronal activities specifically up-regulate the transcription and translation of unique BDNF transcripts. We also discuss some of the recent reports that emphasize the epigenetic regulation of BDNF transcription.

Keywords: Brain-derived neurotrophic factor; cAMP-responsive element; calcium-responsive element; intracellular signaling; neuroplasticity; transcription and translation.

Figures

Figure 1

The structure of mouse and rat BDNF gene. BDNF gene consists of eight 5’ exons (I-VIII) and one 3’ exon (IX). Introns in the gene are presented as straight horizontal lines. The protein-coding region is shown as a dark box, and the non-coding exon regions are shown as open boxes. Three alternative splicing sites (A, B and C) in exon II and the two poly-adenylation sites (polyA site) are indicated with arrows. Exon IXA is the 5’ extended coding exon. Adapted from Aid et al., 2007 [35].

Figure 2

The arrangement of functional cis-elements and the corresponding transcription factors in BDNF promoter IV. The relative location of the sequences to the transcription initiation site (+1) is labeled. The E-Box and the NFκB sequence have one base pair overlap.

Figure 3

Ca2+-stimulated adenylyl cyclase activity is required for learning-induced BDNF exon I transcription. Two- to three-month old wild type (n = 21) and AC1/AC8 DKO (n = 12) mice were trained by contextual fear conditioning. Animals were introduced to the contextual chamber, and allowed to explore for 2 min, after which 3 mild electric foot shocks (0.7 mA, 2 sec duration) were delivered with 20 sec intervals. Animals remained in the chamber for 1 min after the last shock, and were then returned to their home cages. The control animals only received 3 shocks without exposure to the contextual chamber. Hippocampi were collected 2 hours after training. The procedures have been approved by the Institutional Animal Care and Use Committee at Michigan State University. The mRNA levels of BDNF exon I, BDNF exon IV, and c-fos were determined by quantitative RT-PCR, and normalized to GADPH mRNA level. The primers used for BDNF exon I were ACTCAAAGGGAAACGTGTCTC (forward) and GCCTTCATGCAACCGAAGTA (reverse); the primers used for exon IV were CTCCGCCATGCAATTTCCAC (forward) and GCCTTCATGCAACCGAAGTA (reverse); the primers used for c-fos were AGCCTTTCCTACTACCATCC (forward) and ATTCCGGCACTTGGCTGCAG (reverse); the primers used for GADPH were TCCATGACAACTTTGGCATTGTGG (forward) and GTTGCTGTTGAAGTCGCAGGAGAC (reverse). A. BDNF exon I and c-fos but not BDNF exon IV are significantly increased after contextual training. B. The up-regulation of BDNF exon I and c-fos is abolished in AC1/AC8 DKO mice. N.S.: not significant. C. the arrangement of cis-elements and the corresponding transcription factors in BDNF promoter I. The relative location of the cis-elements to the transcription initiation site (+1) is labeled. The sequences of USFBE and CRE overlap.