Effect of Herbal Toothpaste Versus Conventional One on Black Stains (RCT)
Effect of Herbal Toothpaste Versus Conventional One on Black Stains in a Group of Egyptian Children: A Randomized Controlled Study
Study Overview
Detailed Description
TChildren will be enrolled in the study from the outpatient dental Clinic, Medical Centre of Excellence, National Research Centre, Egypt. After professional polishing of blacks stains subjects will be randomly assigned in two groups of equal number (n=28; subdivided to 14 in each group).
The test group will use herbal toothpaste (Dabur Red); (Garik powder (Red ochre), Pippali (Piper longum), Maricha (Piper nigrum), Sunthi (Zingiberofficinale), Tomarbeej (Zanthoxylumarmatum), Karpoor (Cinnamomumcamphora), Laungka Tail (Oil of Syzygiumaromaticum) and Pudinasatva (Menthapiperita).); the control group will use toothpaste with sodiumfluoride toothpaste (Signal). (Aqua, Hydrogenated Starch Hydrolysate, Hydrated Silica, PEG-32, Zinc Citrate, Sodium Lauryl Sulfate, Aroma, MenthaPiperita Oil, Rosmarinus Officinalis Leaf Oil, Cellulose Gum, Sodium Fluoride, Sodium Saccharin, Glycerin, Sodium Bicarbonate, Limonene, CI 74260).
Both test and control groups will use the assigned toothpaste twice a day for 2 months. The study will be double-blinded; sequentially numbered, opaque, sealed envelopes containing the test or the control tooth paste will be prepared.
At the beginning of the study, all subjects will complete a questionnaire including questions regarding socio-demographic variables such as age and sex. Subjects with BS(test and control groups) will also asked about oral hygiene habits such as type of dental brush (manual or electric), dietary habits such as iron supplementation and type of drinking water consumed (tap or mineral water).
The test and control subjects will receive training for home dental hygiene at enrollment and will be contacted by phone every 2 weeks for 2 months to ensure adherence to the protocol and record any recurrence of black stains.
All enrolled subjects will be followed at the Dental Clinic, National Research Centre, Egypt. The study will be consistent with good clinical practices in accordance with the Ethical Principles of the "64th World Medical Association Declaration of Helsinki". All Participants parents will sign a written informed consent before joining the study after brief explanation of all procedures and time table. A verbal assent will be taken from the child before intervention.
Clinical Examination and Samples Collection:
All subjects with BS (both test and control group) will have intraoral examination and professional oral prophylaxis at the enrollment by the same operator. Intraoral photographs will be collected. Clinical evaluation of BS will be assessed carefully to exclude other causes of dental stains. Mean number of Decayed, Missing, and Filled primary and permanent Teeth index (DMFT/deft) will be also calculated.
Salivary Samples collection Five ml of unstimulated saliva samples from all participants from both test and control groups will be collected in a sterile 15 ml falcon tube according to standard procedures. Samples will be collected before using the herbal and conventional toothpaste and after 2 months of their regular use.
DNA extraction Total DNA from the saliva samples of all participants will be done using genomic commercial DNA extraction kit, according to the supplier's instructions. The integrity of DNA will be checked using agarose gel electrophoresis and the concentration and the purity of DNA samples will be checked using NanoDrop spectrophotometer.
Quantification of bacterial species using qRT-PCR Two species of cariogenic bacteria; Streptococcus mutans and Lactobacillus casei are selected to be involved in this study. In addition, two species of chromogenic bacteria; Actinomyces naeslundii and Prevotella melaninogenica will be included in the present study. The sequences of primers of the selected bacterial species; F=TCGCGAAAAAGATAAACAAACA and R=GCCCCTTCACAGTTGGTTAG for (Streptococcus mutans), F=TTAAAGCCATTCTCAGTTCGGA and R=TACGGCTACCTTGTTACGACTT for (Lactobacillus casei) (12). An-F3: CTGCTGCTGACATCGCCGCTCGTA and An-R3: TCCGCTCGCGCCACCTCTCGTTA for (Actinomyces naeslundii), Pm-F3: TGACCGTAAGAAGAAGTTGCCTGTA and Pm-R3: TTGCGACCGATAGCTGCCTTCATA for (Prevotella melaninogenica) (13). Quantification of the selected bacterial species will be carried out using SYBR green master mix, specific primers, DNA and complete the volume of the reaction mixture using sterile RNase and DNase free water. The reaction will be done using real-time polymerase chain reaction in RT-PCR device.
Study Type
Enrollment (Actual)
Phase
- Not Applicable
Contacts and Locations
Study Locations
-
-
Giza
-
Dokki,, Giza, Egypt, 12622
- National Research Centre
-
-
Participation Criteria
Eligibility Criteria
Ages Eligible for Study
- Child
Accepts Healthy Volunteers
Description
Inclusion criteria:
- Children 6 to 12 years
- Free medical history.
- Presence of black stains covering at least two teeth.
- Good oral hygiene.
Exclusion criteria:
- Children on iron supplements
- Presence of intrinsic stains or fluorosis
- Children using electric toothbrush.
- Children took mouthwash or antibiotic in the last month.
Study Plan
How is the study designed?
Design Details
- Primary Purpose: Treatment
- Allocation: Randomized
- Interventional Model: Parallel Assignment
- Masking: Triple
Arms and Interventions
Participant Group / Arm |
Intervention / Treatment |
|---|---|
|
Experimental: Intervention
Herbal toothpaste
|
Intervention
Other Names:
|
|
Active Comparator: Control
Signal toothpaste
|
Intervention
Other Names:
|
What is the study measuring?
Primary Outcome Measures
Outcome Measure |
Measure Description |
Time Frame |
|---|---|---|
|
Parental satisfaction using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree).
Time Frame: After 2 months
|
using Likert scale regarding both interventions of management of black stains (Each response was scored as follows: (5) strongly agree, (4) agree, (3) neutral, (2) disagree and (1) strongly disagree).
|
After 2 months
|
Secondary Outcome Measures
Outcome Measure |
Measure Description |
Time Frame |
|---|---|---|
|
Recurrence of black stains
Time Frame: After 2 months
|
Recurrence rate of black stains
|
After 2 months
|
Other Outcome Measures
Outcome Measure |
Measure Description |
Time Frame |
|---|---|---|
|
Change in number of bacteria before and after treatment
Time Frame: After 2 months
|
Change in number of bacteria before and after treatment using qRT-PCR regarding both interventions.
|
After 2 months
|
Collaborators and Investigators
Sponsor
Investigators
- Study Director: Mohamed F Rashed, Researcher, National Research Centre, Egypt
Study record dates
Study Major Dates
Study Start (Actual)
Primary Completion (Actual)
Study Completion (Actual)
Study Registration Dates
First Submitted
First Submitted That Met QC Criteria
First Posted (Actual)
Study Record Updates
Last Update Posted (Actual)
Last Update Submitted That Met QC Criteria
Last Verified
More Information
Terms related to this study
Keywords
Other Study ID Numbers
- 341
Plan for Individual participant data (IPD)
Plan to Share Individual Participant Data (IPD)?
Drug and device information, study documents
Studies a U.S. FDA-regulated drug product
Studies a U.S. FDA-regulated device product
This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.