The usefulness of biotyping in the determination of selected pathogenicity determinants in Streptococcus mutans

Wirginia Krzyściak, Katarzyna K Pluskwa, Jakub Piątkowski, Paweł Krzyściak, Anna Jurczak, Dorota Kościelniak, Anna Skalniak, Wirginia Krzyściak, Katarzyna K Pluskwa, Jakub Piątkowski, Paweł Krzyściak, Anna Jurczak, Dorota Kościelniak, Anna Skalniak

Abstract

Background: Streptococcus mutans is known to be a primary etiological factor of dental caries, a widespread and growing disease in Polish children. Recognition of novel features determining the pathogenicity of this pathogen may contribute to understanding the mechanisms of bacterial infections.The goal of the study was to determine the activity of prephenate dehydrogenase (PHD) and to illuminate the role of the enzyme in S. mutans pathogenicity. The strains were biotyped based on STREPTOtest 24 biochemical identification tests and the usefulness of biotyping in the determination of S. mutans pathogenicity determinants was examined.

Results: Out of ninety strains isolated from children with deciduous teeth fifty three were classified as S. mutans species. PDH activity was higher (21.69 U/mg on average) in the experimental group compared to the control group (5.74 U/mg on average) (P <0.001). Moreover, it was demonstrated that biotype I, established basing on the biochemical characterization of the strain, was predominant (58.5%) in oral cavity streptococcosis. Its dominance was determined by higher PDH activity compared to biotypes II and III (P = 0.0019).

Conclusions: The usefulness of biotyping in the determination of Streptococcus mutans pathogenicity determinants was demonstrated. The obtained results allow for better differentiation of S. mutans species and thus may contribute to recognition of pathogenic bacteria transmission mechanisms and facilitate treatment.

Figures

Figure 1
Figure 1
16s rDNA sequencing strategy. A. NC_004350.2 – Streptococcus mutans UA159 genome, SMU_r04 - 16S ribosomal RNA gene (length 1552 bp), grey arrow – forward primer (CGCTGGCGGCGTGCCTAATA), white arrow – reverse primer (TGCAAAGCAGGCGCTCTCCC). B. PCR product (length 1620 bp). C. Average sequencing read length for forward (grey stripe) and reverse (white stripe) primer.
Figure 2
Figure 2
Role of the prephenate dehydrogenase (PDH) in the metabolism of aromatic amino acids.
Figure 3
Figure 3
Percentage of Streptococcus species in the material using a selective medium HLR-S. The results of phenotypic analysis using the biochemical test.
Figure 4
Figure 4
Range and relative share of Streptococcus species in groups - study and control.
Figure 5
Figure 5
The incidence of S. mutans species divided into groups. On the left, the results obtained in our study; on the right, a comparison of our results with those of other authors.
Figure 6
Figure 6
Distribution of enzymes selected for biotyping (graphs marked in blue).
Figure 7
Figure 7
Dendrogram with marked S. mutans biotypes.
Figure 8
Figure 8
Graphical interpretation of the Cochran-Cox test, p <0.001. Comparison of average prephenate dehydrogenase enzymatic activities, PDH in the control and study group; *** - p <0.001.
Figure 9
Figure 9
Graphical interpretation of the Kruskal-Wallis test, p = 0.0019. Comparison of median values of prephenate dehydrogenase (PDH) in biotypes (I-III).

References

    1. Morou-Bermudez E, Billings RJ, Burne RA, Elias-Boneta A. Caries risk pyramid: a practical biological approach to caries management by risk assessment. P R Health Sci J. 2011;30(4):165–166.
    1. Szczepańska J, Lubowiecka-Gontarek B, Pawłowska E, Szydłowska-Walendowska B. Czynniki ryzyka próchnicy związane z żywieniem a liczebność bakterii próchnicotwórczych w ślinie dzieci w wieku 3 lat. Dent Med Probems. 2008;45(2):156–164.
    1. Szymańska J, Szalewski L. Próchnica zębów mlecznych w populacji polskich dzieci w wieku 0,5-6 lat. Zdr Publ. 2011;121(1):86–89.
    1. Kanasi E, Dewhirst FE, Chalmers NI, Kent R Jr, Moore A, Hughes CV, Pradhan N, Loo CY, Tanner AC. Clonal analysis of the microbiota of severe early childhood caries. Caries Res. 2010;44(5):485–497. doi: 10.1159/000320158.
    1. Tanner AC, Mathney JM, Kent RL, Chalmers NI, Hughes CV, Loo CY, Pradhan N, Kanasi E, Hwang J, Dahlan MA, Papadopolou E, Dewhirst FE. Cultivable anaerobic microbiota of severe early childhood caries. J Clin Microbiol. 2011;49(4):1464–1474. doi: 10.1128/JCM.02427-10.
    1. Argimon S, Caufield PW. Distribution of putative virulence genes in Streptococcus mutans strains does not correlate with caries experience. J Clin Microbiol. 2011;49(3):984–992. doi: 10.1128/JCM.01993-10.
    1. Santiago B, MacGilvray M, Faustoferri RC, Quivey RG Jr. The branched-chain amino acid aminotransferase encoded by ilvE is involved in acid tolerance in Streptococcus mutans. J Bacteriol. 2012;194(8):2010–2019. doi: 10.1128/JB.06737-11.
    1. Lemos JA, Burne RA. A model of efficiency: stress tolerance by Streptococcus mutans. Microbiology. 2008;154(Pt 11):3247–3255.
    1. Ku HK, Park SR, Yang I, Kim SK. Expression and functional characterization of prephenate dehydrogenase from Streptococcus mutans. Proc Biol. 2010;45(4):607–612.
    1. Xu S, Yang Y, Jin R, Zhang M, Wang H. Purification and characterization of a functionally active Mycobacterium tuberculosis prephenate dehydrogenase. Protein Expr Purif. 2006;49(2):151–158. doi: 10.1016/j.pep.2006.05.020.
    1. Chiu HJ, Abdubek P, Astakhova T, Axelrod HL, Carlton D, Clayton T, Das D, Deller MC, Duan L, Feuerhelm J, Grant JC, Grzechnik A, Han GW, Jaroszewski L, Jin KK, Klock HE, Knuth MW, Kozbial P, Krishna SS, Kumar A, Marciano D, McMullan D, Miller MD, Morse AT, Nigoghossian E, Okach L, Reyes R, Tien HJ, Trame CB, van den Bedem H. et al.The structure of Haemophilus influenzae prephenate dehydrogenase suggests unique features of bifunctional TyrA enzymes. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2010;66(Pt 10):1317–1325.
    1. Berry A, Jensen RA, Hendry AT. Enzymic arrangement and allosteric regulation of the aromatic amino acid pathway in Neisseria gonorrhoeae. Arch Microbiol. 1987;149(2):87–94. doi: 10.1007/BF00425071.
    1. Chen S, Vincent S, Wilson DB, Ganem B. Mapping of chorismate mutase and prephenate dehydrogenase domains in the Escherichia coli T-protein. Eur J Biochem. 2003;270(4):757–763. doi: 10.1046/j.1432-1033.2003.03438.x.
    1. Toi CS, Cleaton-Jones PE, Daya NP. Mutans streptococci and other caries-associated acidogenic bacteria in five-year-old children in South Africa. Oral Microbiol Immunol. 1999;14(4):238–243. doi: 10.1034/j.1399-302X.1999.140407.x.
    1. Facklam R. What happened to the streptococci: overview of taxonomic and nomenclature changes. Clin Microbiol Rev. 2002;15(4):613–630. doi: 10.1128/CMR.15.4.613-630.2002.
    1. Dabrowska-Szponar M, Kubielas H. Serologic and genetic analysis of group B streptococci isolated from adult patients. Med Dosw Mikrobiol. 2006;58(4):283–289.
    1. Teles C, Smith A, Ramage G, Lang S. Identification of clinically relevant viridans group streptococci by phenotypic and genotypic analysis. Eur J Clin Microbiol Infect Dis. 2011;30(2):243–250. doi: 10.1007/s10096-010-1076-y.
    1. Brtkova A, Filipova M, Drahovska H, Bujdakova H. Characterization of enterococci of animal and environmental origin using phenotypic methods and comparison with PCR based methods. Vet Med. 2010;55(3):97–105.
    1. Barnham M, Cole G, Efstratiou A, Tagg JR, Skjold SA. Characterization of Streptococcus zooepidemicus (Lancefield group C) from human and selected animal infections. Epidemiol Infect. 1987;98(2):171–182. doi: 10.1017/S0950268800061884.
    1. Aarestrup FM, Jensen NE. Genotypic and phenotypic diversity of Streptococcus dysgalactiae strains isolated from clinical and subclinical cases of bovine mastitis. Vet Microbiol. 1996;53(3–4):315–323.
    1. Dabrowska-Szponar M, Galinski J. Biochemical typing as a method of differentiating group B streptococcus. Med Dosw Mikrobiol. 2001;53(3):227–232.
    1. Yoo SY, Park SJ, Jeong DK, Kim KW, Lim SH, Lee SH, Choe SJ, Chang YH, Park I, Kook JK. Isolation and characterization of the mutans streptococci from the dental plaques in Koreans. J Microbiol. 2007;45(3):246–255.
    1. Li L, He J, Eckert R, Yarbrough D, Lux R, Anderson M, Shi W. Design and characterization of an acid-activated antimicrobial peptide. Chem Biol Drug Des. 2010;75(1):127–132. doi: 10.1111/j.1747-0285.2009.00904.x.
    1. Bahnan W, Hashwa F, Araj G, Tokajian S. emm typing, antibiotic resistance and PFGE analysis of Streptococcus pyogenes in Lebanon. J Med Microbiol. 2011;60(Pt 1):98–101.
    1. Kruger EF, Byrne BA, Pesavento P, Hurley KF, Lindsay LL, Sykes JE. Relationship between clinical manifestations and pulsed-field gel profiles of Streptococcus canis isolates from dogs and cats. Vet Microbiol. 2010;146(1–2):167–171.
    1. Moser SA, Mitchell SC, Ruby JD, Momeni S, Osgood RC, Whiddon J, Childers NK. Repetitive extragenic palindromic PCR for study of Streptococcus mutans diversity and transmission in human populations. J Clin Microbiol. 2010;48(2):599–602. doi: 10.1128/JCM.01828-09.
    1. Sadowy E, Kuch A, Gniadkowski M, Hryniewicz W. Expansion and evolution of the Streptococcus pneumoniae Spain9V-ST156 clonal complex in Poland. Antimicrob Agents Chemother. 2010;54(5):1720–1727. doi: 10.1128/AAC.01340-09.
    1. Jans C, Lacroix C, Meile L. A novel multiplex PCR/RFLP assay for the identification of Streptococcus bovis/Streptococcus equinus complex members from dairy microbial communities based on the 16S rRNA gene. FEMS Microbiol Lett. 2012;326(2):144–150. doi: 10.1111/j.1574-6968.2011.02443.x.
    1. Sato T, Hu JP, Ohki K, Yamaura M, Washio J, Matsuyama J, Takahashi N. Identification of mutans streptococci by restriction fragment length polymorphism analysis of polymerase chain reaction-amplified 16S ribosomal RNA genes. Oral Microbiol Immunol. 2003;18(5):323–326. doi: 10.1034/j.1399-302X.2003.00095.x.
    1. Wan AK, Seow WK, Walsh LJ, Bird PS. Comparison of five selective media for the growth and enumeration of Streptococcus mutans. Aust Dent J. 2002;47(1):21–26. doi: 10.1111/j.1834-7819.2002.tb00298.x.
    1. Sadatullah S, Mohamed NH, Razak FA. The antimicrobial effect of 0.1 ppm ozonated water on 24-hour plaque microorganisms in situ. Braz Oral Res. 2012;26(2):126–131. doi: 10.1590/S1806-83242012000200007.
    1. Millar BC, Jiru X, Moore JE, Earle JA. A simple and sensitive method to extract bacterial, yeast and fungal DNA from blood culture material. J Microbiol Methods. 2000;42(2):139–147. doi: 10.1016/S0167-7012(00)00174-3.
    1. Chen CC, Teng LJ, Chang TC. Identification of clinically relevant viridans group streptococci by sequence analysis of the 16S-23S ribosomal DNA spacer region. J Clin Microbiol. 2004;42(6):2651–2657. doi: 10.1128/JCM.42.6.2651-2657.2004.
    1. Nielsen XC, Justesen US, Dargis R, Kemp M, Christensen JJ. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene. J Clin Microbiol. 2009;47(4):932–939. doi: 10.1128/JCM.01449-08.
    1. Whiley RA, Duke B, Hardie JM, Hall LM. Heterogeneity among 16S-23S rRNA intergenic spacers of species within the ‘Streptococcus milleri group’. Microbiology. 1995;141(Pt 6):1461–1467.
    1. Champney WS, Jensen RA. The enzymology of prephenate dehydrogenase in Bacillus subtilis. J Biol Chem. 1970;245(15):3763–3770.
    1. Ahmad S, Weisburg WG, Jensen RA. Evolution of aromatic amino acid biosynthesis and application to the fine-tuned phylogenetic positioning of enteric bacteria. J Bacteriol. 1990;172(2):1051–1061.
    1. Xia T, Zhao G, Fischer RS, Jensen RA. A monofunctional prephenate dehydrogenase created by cleavage of the 5′ 109 bp of the tyrA gene from Erwinia herbicola. J Gen Microbiol. 1992;138(7):1309–1316. doi: 10.1099/00221287-138-7-1309.
    1. Choi EJ, Lee SH, Kim YJ. Quantitative real-time polymerase chain reaction for Streptococcus mutans and Streptococcus sobrinus in dental plaque samples and its association with early childhood caries. Int J Paediatr Dent. 2009;19(2):141–147. doi: 10.1111/j.1365-263X.2008.00942.x.
    1. Brauncajs M, Krzeminski Z, Sakowska D. Comparison of bacterial flora in the oral cavity of children and adults. Med Dosw Mikrobiol. 2004;56(4):365–369.
    1. Facklam RR. Characteristics of Streptococcus mutans isolated from human dental plaque and blood. Int J Syst Bacteriol. 1974;24:313–319. doi: 10.1099/00207713-24-3-313.
    1. De La Higuera A, Gutierrez J, Liebana J, Garcia-Mendoza A, Castillo A. A new biotyping method for Streptococcus mutans with the API ZYM system. Clin Microbiol Infect. 1999;5(2):88–91. doi: 10.1111/j.1469-0691.1999.tb00108.x.
    1. Ferrazzano GF, Amato I, Ingenito A, De Natale A, Pollio A. Anti-cariogenic effects of polyphenols from plant stimulant beverages (cocoa, coffee, tea) Fitoterapia. 2009;80(5):255–262. doi: 10.1016/j.fitote.2009.04.006.
    1. Hillman JD, McDonell E, Cramm T, Hillman CH, Zahradnik RT. A spontaneous lactate dehydrogenase deficient mutant of Streptococcus rattus for use as a probiotic in the prevention of dental caries. J Appl Microbiol. 2009;107(5):1551–1558. doi: 10.1111/j.1365-2672.2009.04333.x.
    1. Ku HK, Do NH, Song JS, Choi S, Yeon SH, Shin MH, Kim KJ, Park SR, Park IY, Kim SK, Lee SJ. Crystal structure of prephenate dehydrogenase from Streptococcus mutans. Int J Biol Macromol. 2011;49(4):761–766. doi: 10.1016/j.ijbiomac.2011.07.009.

Source: PubMed

Sponzoři a spolupracovníci

Zdravotní podmínky

Drogové intervence

3
Předplatit