Effect of Oryza Sativa l Extract to LPS, ZO-1, and Intestinal Microbiota in Obese Individuals

Effect of Oryza Sativa l Extract to Serum Lipopolysaccharide, Tight Junction Protein 1 (ZO-1), and Intestinal Microbiota Expression Among Obese Individual

Background :

Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters.

Objective :

To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults.

Method:

A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention

Hypothesis:

Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.

Study Overview

• Status: Not yet recruiting
• Conditions: Obesity
• Intervention / Treatment: Dietary supplement: Oryza Sativa Extract; Dietary supplement: Control

Detailed Description

Method:

1. Non Randomized clinical trial with double-blind
2. Participants will be recruited consecutively
3. Matching technique will be applied following several variables adjustment
4. Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group

Sample size calculation:

The difference between two independent means sample size calculation is applied following the elements below:

a. Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14

Intervention :

1. Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg.
2. Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where :

anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9

Control

a. Active comparator using citric acid and sorbitol mixture

Biological sample:

1. Serum sample preparation :

   Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C.

2. Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below :

   1. Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC),
   2. Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)),
   3. Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA),
   4. Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA),
   5. Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA)

Protection of Human subject according to Helsinki Declaration

1. Participants are allowed to receive the information of research including purpose, possible intervention, and side effects.
2. Possible side effect including :
3. Participants are allowed to withdraw from the study for any reason.

Statistical Analysis Plan

1. Descriptive statistic of the baseline
2. The bivariate analysis between all variables and the outcomes
3. Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups
4. The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups
5. Alternative statistical test: Linear mixed model to adjust the fixed and random effects.

• Study Type: Interventional
• Enrollment (Anticipated): 42
• Phase: Not Applicable

Contacts and Locations

• Study Contact: Name: Bumi Herman, Ph.D; Phone Number: +66638275008; Email: bumiherman@med.unhas.ac.id

Study Locations

• Indonesia
  • South Sulawesi
    • Makassar, South Sulawesi, Indonesia, 90245
      • Hasanuddin University Medical Research Center / HUMRC
      • Contact: Armanto Makmun, M.Kes; Phone Number: +6285299900032; Email: armanto.makmun@umi.ac.id
      • Contact: Rachmat Syamsu, M.Kes; Phone Number: +6285242150099; Email: rachmatfaisal.syamsu@umi.ac.id
      • Principal Investigator: Armanto Makmun, M.Kes
      • Principal Investigator: Agussalim Bukhari, Ph.D
      • Principal Investigator: Aminuddin Aminuddin, Ph.D
      • Principal Investigator: Nurpudji A Taslim, Prof
      • Principal Investigator: Rachmat F Syamsu, M.Kes
      • Sub-Investigator: Bumi Herman, Ph.D

Participation Criteria

Eligibility Criteria

• Ages Eligible for Study: 18 years to 21 years (Adult)
• Accepts Healthy Volunteers: Yes
• Genders Eligible for Study: Male

Description

Inclusion Criteria

1. No consumption of the antioxidant supplement
2. No consumption of prebiotic and probiotic
3. Currently not undergo specific diet

Exclusion Criteria

1. Current smoker
2. Diagnosed with chronic diseases
3. Patients with altered kidney and liver function
4. Unable to participate for any reason

Study Plan

How is the study designed?

Design Details

• Primary Purpose: Treatment
• Allocation: Non-Randomized
• Interventional Model: Parallel Assignment
• Masking: Triple

Number of Arms

3

Arms and Interventions

Participant Group / Arm	Intervention / Treatment
Experimental: Obese with Oryza sativa extract; The group with a body mass index of more than 25 kg/m2 that receive the Oryza Sativa Extract	Dietary supplement: Oryza Sativa Extract; The product is a suspension of 5.6 gram/100 mL given once daily, contains 71.9%, purple in color, range pH 3-5. Stored in the darker bottle. The frequency of administration is once-daily after the meal.
Active Comparator: Obese with control; The group with a body mass index of more than 25 kg/m2 that receive the citric acid and sorbitol mixture	Dietary supplement: Control; citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal
Active Comparator: Normal Body Mass Index; The group with a body mass index of less than 25 kg/m2 that receive the citric acid and sorbitol mixture	Dietary supplement: Control; citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal

What is the study measuring?

Primary Outcome Measures

Outcome Measure	Measure Description	Time Frame
Lipopolysaccharide (LPS) level of Serum	Measured using Enzyme-Linked Immunosorbent Assay (ELISA)	Changes of LPS value from baseline to the last day of intervention (three weeks)
Microbiota Level in Stool sample	Measured using primary PCR of total microbiota, Firmicutes-Lactobacillus, Bacteroidetes-Bacteroides fragilis, Actinobacteria-Bifidobacterium and Proteobacteria-E.Coli	Changes of Microbiota value from baseline to the last day of intervention (three weeks)

Secondary Outcome Measures

Outcome Measure	Measure Description	Time Frame
Zonula Occludens 1 (ZO1) serum level	Measured using Enzyme-Linked Immunosorbent Assay (ELISA)	Changes of ZO1 value from baseline to the last day of intervention (three weeks)

Collaborators and Investigators

• Sponsor: Hasanuddin University
• Investigators: Principal Investigator: Agussalim Bukhari, Ph.D, Hasanuddin University; Principal Investigator: Nurpudji Taslim, Prof., Hasanuddin University; Principal Investigator: Aminuddin Aminuddin, Ph.D, Hasanuddin University; Principal Investigator: Armanto Makmun, M.Kes, Universitas Muslim Indonesia; Principal Investigator: Rachmat Syamsu, M.Kes, Universitas Muslim Indonesia; Principal Investigator: Bumi Herman, MD. Ph.D, Chulalongkorn University

Publications and helpful links

General Publications

• Angelakis E, Armougom F, Million M, Raoult D. The relationship between gut microbiota and weight gain in humans. Future Microbiol. 2012 Jan;7(1):91-109. doi: 10.2217/fmb.11.142.
• Aguirre M, Venema K. Does the Gut Microbiota Contribute to Obesity? Going beyond the Gut Feeling. Microorganisms. 2015 Apr 27;3(2):213-35. doi: 10.3390/microorganisms3020213.
• Tehrani AB, Nezami BG, Gewirtz A, Srinivasan S. Obesity and its associated disease: a role for microbiota? Neurogastroenterol Motil. 2012 Apr;24(4):305-11. doi: 10.1111/j.1365-2982.2012.01895.x. Epub 2012 Feb 20.
• Tan J, Li Y, Hou DX, Wu S. The Effects and Mechanisms of Cyanidin-3-Glucoside and Its Phenolic Metabolites in Maintaining Intestinal Integrity. Antioxidants (Basel). 2019 Oct 12;8(10):479. doi: 10.3390/antiox8100479.
• Morais CA, de Rosso VV, Estadella D, Pisani LP. Anthocyanins as inflammatory modulators and the role of the gut microbiota. J Nutr Biochem. 2016 Jul;33:1-7. doi: 10.1016/j.jnutbio.2015.11.008. Epub 2015 Nov 26.
• Min SW, Ryu SN, Kim DH. Anti-inflammatory effects of black rice, cyanidin-3-O-beta-D-glycoside, and its metabolites, cyanidin and protocatechuic acid. Int Immunopharmacol. 2010 Aug;10(8):959-66. doi: 10.1016/j.intimp.2010.05.009.
• Lee B, Moon KM, Kim CY. Tight Junction in the Intestinal Epithelium: Its Association with Diseases and Regulation by Phytochemicals. J Immunol Res. 2018 Dec 16;2018:2645465. doi: 10.1155/2018/2645465. eCollection 2018.
• Ito VC, Lacerda LG. Black rice (Oryza sativa L.): A review of its historical aspects, chemical composition, nutritional and functional properties, and applications and processing technologies. Food Chem. 2019 Dec 15;301:125304. doi: 10.1016/j.foodchem.2019.125304. Epub 2019 Jul 31.
• Igwe EO, Charlton KE, Probst YC, Kent K, Netzel ME. A systematic literature review of the effect of anthocyanins on gut microbiota populations. J Hum Nutr Diet. 2019 Feb;32(1):53-62. doi: 10.1111/jhn.12582. Epub 2018 Jul 8.
• Hersoug LG, Moller P, Loft S. Gut microbiota-derived lipopolysaccharide uptake and trafficking to adipose tissue: implications for inflammation and obesity. Obes Rev. 2016 Apr;17(4):297-312. doi: 10.1111/obr.12370. Epub 2015 Dec 29.
• Bae IY, An JS, Oh IK, Lee HG. Optimized preparation of anthocyanin-rich extract from black rice and its effects on in vitro digestibility. Food Sci Biotechnol. 2017 Aug 28;26(5):1415-1422. doi: 10.1007/s10068-017-0188-x. eCollection 2017.

Study record dates

Study Major Dates

• Study Start (Anticipated): April 10, 2021
• Primary Completion (Anticipated): May 1, 2021
• Study Completion (Anticipated): June 1, 2021

Study Registration Dates

• First Submitted: March 30, 2021
• First Submitted That Met QC Criteria: March 31, 2021
• First Posted (Actual): April 1, 2021

Study Record Updates

• Last Update Posted (Actual): April 5, 2021
• Last Update Submitted That Met QC Criteria: April 1, 2021
• Last Verified: April 1, 2021

More Information

Terms related to this study

• Keywords: Obesity; Lipopolysaccharide; Intestinal Microbiota; Anthocyanin; Oryza sativa; Zonula Occludens 1
• Additional Relevant MeSH Terms: Overnutrition; Nutrition Disorders; Overweight; Body Weight; Obesity
• Other Study ID Numbers: 1803211718

Plan for Individual participant data (IPD)

• Plan to Share Individual Participant Data (IPD)?: NO
• IPD Plan Description: Only protocol could be shared for public

Drug and device information, study documents

• Studies a U.S. FDA-regulated drug product: No
• Studies a U.S. FDA-regulated device product: No