Effect of Oryza Sativa l Extract to LPS, ZO-1, and Intestinal Microbiota in Obese Individuals

April 1, 2021 updated by: Bumi Herman, Hasanuddin University

Effect of Oryza Sativa l Extract to Serum Lipopolysaccharide, Tight Junction Protein 1 (ZO-1), and Intestinal Microbiota Expression Among Obese Individual

Background :

Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters.

Objective :

To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults.

Method:

A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention

Hypothesis:

Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.

Study Overview

Status

Not yet recruiting

Conditions

Detailed Description

Method:

  1. Non Randomized clinical trial with double-blind
  2. Participants will be recruited consecutively
  3. Matching technique will be applied following several variables adjustment
  4. Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group

Sample size calculation:

The difference between two independent means sample size calculation is applied following the elements below:

a. Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14

Intervention :

  1. Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg.
  2. Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where :

anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9

Control

a. Active comparator using citric acid and sorbitol mixture

Biological sample:

  1. Serum sample preparation :

    Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C.

  2. Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below :

    1. Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC),
    2. Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)),
    3. Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA),
    4. Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA),
    5. Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA)

Protection of Human subject according to Helsinki Declaration

  1. Participants are allowed to receive the information of research including purpose, possible intervention, and side effects.
  2. Possible side effect including :
  3. Participants are allowed to withdraw from the study for any reason.

Statistical Analysis Plan

  1. Descriptive statistic of the baseline
  2. The bivariate analysis between all variables and the outcomes
  3. Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups
  4. The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups
  5. Alternative statistical test: Linear mixed model to adjust the fixed and random effects.

Study Type

Interventional

Enrollment (Anticipated)

42

Phase

  • Not Applicable

Contacts and Locations

This section provides the contact details for those conducting the study, and information on where this study is being conducted.

Study Contact

Study Locations

    • South Sulawesi
      • Makassar, South Sulawesi, Indonesia, 90245
        • Hasanuddin University Medical Research Center / HUMRC
        • Contact:
        • Contact:
        • Principal Investigator:
          • Armanto Makmun, M.Kes
        • Principal Investigator:
          • Agussalim Bukhari, Ph.D
        • Principal Investigator:
          • Aminuddin Aminuddin, Ph.D
        • Principal Investigator:
          • Nurpudji A Taslim, Prof
        • Principal Investigator:
          • Rachmat F Syamsu, M.Kes
        • Sub-Investigator:
          • Bumi Herman, Ph.D

Participation Criteria

Researchers look for people who fit a certain description, called eligibility criteria. Some examples of these criteria are a person's general health condition or prior treatments.

Eligibility Criteria

Ages Eligible for Study

18 years to 21 years (Adult)

Accepts Healthy Volunteers

Yes

Genders Eligible for Study

Male

Description

Inclusion Criteria

  1. No consumption of the antioxidant supplement
  2. No consumption of prebiotic and probiotic
  3. Currently not undergo specific diet

Exclusion Criteria

  1. Current smoker
  2. Diagnosed with chronic diseases
  3. Patients with altered kidney and liver function
  4. Unable to participate for any reason

Study Plan

This section provides details of the study plan, including how the study is designed and what the study is measuring.

How is the study designed?

Design Details

  • Primary Purpose: Treatment
  • Allocation: Non-Randomized
  • Interventional Model: Parallel Assignment
  • Masking: Triple

Arms and Interventions

Participant Group / Arm
Intervention / Treatment
Experimental: Obese with Oryza sativa extract
The group with a body mass index of more than 25 kg/m2 that receive the Oryza Sativa Extract
The product is a suspension of 5.6 gram/100 mL given once daily, contains 71.9%, purple in color, range pH 3-5. Stored in the darker bottle. The frequency of administration is once-daily after the meal.
Active Comparator: Obese with control
The group with a body mass index of more than 25 kg/m2 that receive the citric acid and sorbitol mixture
citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal
Active Comparator: Normal Body Mass Index
The group with a body mass index of less than 25 kg/m2 that receive the citric acid and sorbitol mixture
citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal

What is the study measuring?

Primary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Lipopolysaccharide (LPS) level of Serum
Time Frame: Changes of LPS value from baseline to the last day of intervention (three weeks)
Measured using Enzyme-Linked Immunosorbent Assay (ELISA)
Changes of LPS value from baseline to the last day of intervention (three weeks)
Microbiota Level in Stool sample
Time Frame: Changes of Microbiota value from baseline to the last day of intervention (three weeks)
Measured using primary PCR of total microbiota, Firmicutes-Lactobacillus, Bacteroidetes-Bacteroides fragilis, Actinobacteria-Bifidobacterium and Proteobacteria-E.Coli
Changes of Microbiota value from baseline to the last day of intervention (three weeks)

Secondary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Zonula Occludens 1 (ZO1) serum level
Time Frame: Changes of ZO1 value from baseline to the last day of intervention (three weeks)
Measured using Enzyme-Linked Immunosorbent Assay (ELISA)
Changes of ZO1 value from baseline to the last day of intervention (three weeks)

Collaborators and Investigators

This is where you will find people and organizations involved with this study.

Investigators

  • Principal Investigator: Agussalim Bukhari, Ph.D, Hasanuddin University
  • Principal Investigator: Nurpudji Taslim, Prof., Hasanuddin University
  • Principal Investigator: Aminuddin Aminuddin, Ph.D, Hasanuddin University
  • Principal Investigator: Armanto Makmun, M.Kes, Universitas Muslim Indonesia
  • Principal Investigator: Rachmat Syamsu, M.Kes, Universitas Muslim Indonesia
  • Principal Investigator: Bumi Herman, MD. Ph.D, Chulalongkorn University

Publications and helpful links

The person responsible for entering information about the study voluntarily provides these publications. These may be about anything related to the study.

General Publications

Study record dates

These dates track the progress of study record and summary results submissions to ClinicalTrials.gov. Study records and reported results are reviewed by the National Library of Medicine (NLM) to make sure they meet specific quality control standards before being posted on the public website.

Study Major Dates

Study Start (Anticipated)

April 10, 2021

Primary Completion (Anticipated)

May 1, 2021

Study Completion (Anticipated)

June 1, 2021

Study Registration Dates

First Submitted

March 30, 2021

First Submitted That Met QC Criteria

March 31, 2021

First Posted (Actual)

April 1, 2021

Study Record Updates

Last Update Posted (Actual)

April 5, 2021

Last Update Submitted That Met QC Criteria

April 1, 2021

Last Verified

April 1, 2021

More Information

Terms related to this study

Plan for Individual participant data (IPD)

Plan to Share Individual Participant Data (IPD)?

NO

IPD Plan Description

Only protocol could be shared for public

Drug and device information, study documents

Studies a U.S. FDA-regulated drug product

No

Studies a U.S. FDA-regulated device product

No

This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.

Clinical Trials on Obesity

Clinical Trials on Oryza Sativa Extract

Subscribe