Association Between Ferroptosis and Epilepsy

Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children

Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.

Study Overview

Status

Completed

Conditions

Intervention / Treatment

Detailed Description

To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy. Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues. Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children. Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls. Three glutathione peroxidase 4 (GPX4)dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11(SLC7A11), GPX4, tumor protein 53 (P53). Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.

Study Type

Observational

Enrollment (Actual)

40

Contacts and Locations

This section provides the contact details for those conducting the study, and information on where this study is being conducted.

Study Locations

    • Jiangsu
      • Wuxi, Jiangsu, China, 226600
        • Affiliated Hospital of JiangNan University, Department of Pediatrics

Participation Criteria

Researchers look for people who fit a certain description, called eligibility criteria. Some examples of these criteria are a person's general health condition or prior treatments.

Eligibility Criteria

Ages Eligible for Study

6 years to 12 years (Child)

Accepts Healthy Volunteers

Yes

Genders Eligible for Study

All

Sampling Method

Non-Probability Sample

Study Population

school-aged children who admitted to our hospital from Jan 20, 2021 to Jan 1, 2022

Description

Seizure group

Inclusion Criteria:

  1. Aged between 6 and 12 years old
  2. Newly diagnosed untreated epilepsy

Exclusion Criteria:

  1. Treated with medicine or another therapy
  2. Had history of cancer diseases
  3. Had history of endocrine diseases

Healthy control group

Inclusion Criteria:

1. Aged between 6 and 12 years old

Exclusion Criteria:

  1. Had history of epilepsy
  2. Had history of cancer diseases
  3. Had history of endocrine diseases

Study Plan

This section provides details of the study plan, including how the study is designed and what the study is measuring.

How is the study designed?

Design Details

Cohorts and Interventions

Group / Cohort
Intervention / Treatment
Seizures group
20 newly diagnosed untreated school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups
Healthy control group
20 age-matched healthy school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups

What is the study measuring?

Primary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Rt-qPCR
Time Frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.

Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow:

GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC

Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.

Secondary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Western blot
Time Frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
Western blotting is an important technique used in cell and molecular biology. Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53.
Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.

Collaborators and Investigators

This is where you will find people and organizations involved with this study.

Investigators

  • Study Director: YueYing Liu, Affiliated Hospital of JiangNan University, Department of Pediatrics

Study record dates

These dates track the progress of study record and summary results submissions to ClinicalTrials.gov. Study records and reported results are reviewed by the National Library of Medicine (NLM) to make sure they meet specific quality control standards before being posted on the public website.

Study Major Dates

Study Start (Actual)

January 20, 2021

Primary Completion (Actual)

November 15, 2021

Study Completion (Actual)

January 1, 2022

Study Registration Dates

First Submitted

February 23, 2022

First Submitted That Met QC Criteria

March 4, 2022

First Posted (Actual)

March 8, 2022

Study Record Updates

Last Update Posted (Actual)

April 15, 2022

Last Update Submitted That Met QC Criteria

April 8, 2022

Last Verified

February 1, 2022

More Information

Terms related to this study

Other Study ID Numbers

  • 2022/2/21

Plan for Individual participant data (IPD)

Plan to Share Individual Participant Data (IPD)?

NO

IPD Plan Description

Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, we hypothesis GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.

Drug and device information, study documents

Studies a U.S. FDA-regulated drug product

No

Studies a U.S. FDA-regulated device product

No

This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.

Clinical Trials on Epilepsy

Clinical Trials on SLC7A11, GPX4, P53

Subscribe