- ICH GCP
- 미국 임상 시험 레지스트리
- 임상시험 NCT05269901
Association Between Ferroptosis and Epilepsy
2022년 4월 8일 업데이트: Affiliated Hospital of Jiangnan University
Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children
Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures.
Nearly 10.5 million children worldwide are estimated to have active epilepsy.
Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy.
Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death.
The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions.
Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability.
In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant.
Therefore, it is necessary to develop a novel therapy to treat epilepsy.
Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation.
It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis.
Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
연구 개요
상세 설명
To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy.
Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues.
Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children.
Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls.
Three glutathione peroxidase 4 (GPX4)dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11(SLC7A11), GPX4, tumor protein 53 (P53).
Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.
연구 유형
관찰
등록 (실제)
40
연락처 및 위치
이 섹션에서는 연구를 수행하는 사람들의 연락처 정보와 이 연구가 수행되는 장소에 대한 정보를 제공합니다.
연구 장소
-
-
Jiangsu
-
Wuxi, Jiangsu, 중국, 226600
- Affiliated Hospital of JiangNan University, Department of Pediatrics
-
-
참여기준
연구원은 적격성 기준이라는 특정 설명에 맞는 사람을 찾습니다. 이러한 기준의 몇 가지 예는 개인의 일반적인 건강 상태 또는 이전 치료입니다.
자격 기준
공부할 수 있는 나이
6년 (어린이)
건강한 자원 봉사자를 받아들입니다
예
연구 대상 성별
모두
샘플링 방법
비확률 샘플
연구 인구
school-aged children who admitted to our hospital from Jan 20, 2021 to Jan 1, 2022
설명
Seizure group
Inclusion Criteria:
- Aged between 6 and 12 years old
- Newly diagnosed untreated epilepsy
Exclusion Criteria:
- Treated with medicine or another therapy
- Had history of cancer diseases
- Had history of endocrine diseases
Healthy control group
Inclusion Criteria:
1. Aged between 6 and 12 years old
Exclusion Criteria:
- Had history of epilepsy
- Had history of cancer diseases
- Had history of endocrine diseases
공부 계획
이 섹션에서는 연구 설계 방법과 연구가 측정하는 내용을 포함하여 연구 계획에 대한 세부 정보를 제공합니다.
연구는 어떻게 설계됩니까?
디자인 세부사항
코호트 및 개입
그룹/코호트 |
개입 / 치료 |
---|---|
Seizures group
20 newly diagnosed untreated school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.
|
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups
|
Healthy control group
20 age-matched healthy school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.
|
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups
|
연구는 무엇을 측정합니까?
주요 결과 측정
결과 측정 |
측정값 설명 |
기간 |
---|---|---|
Rt-qPCR
기간: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.
|
Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow: GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC |
Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.
|
2차 결과 측정
결과 측정 |
측정값 설명 |
기간 |
---|---|---|
Western blot
기간: Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
|
Western blotting is an important technique used in cell and molecular biology.
Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53.
|
Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
|
공동 작업자 및 조사자
여기에서 이 연구와 관련된 사람과 조직을 찾을 수 있습니다.
수사관
- 연구 책임자: YueYing Liu, Affiliated Hospital of JiangNan University, Department of Pediatrics
연구 기록 날짜
이 날짜는 ClinicalTrials.gov에 대한 연구 기록 및 요약 결과 제출의 진행 상황을 추적합니다. 연구 기록 및 보고된 결과는 공개 웹사이트에 게시되기 전에 특정 품질 관리 기준을 충족하는지 확인하기 위해 국립 의학 도서관(NLM)에서 검토합니다.
연구 주요 날짜
연구 시작 (실제)
2021년 1월 20일
기본 완료 (실제)
2021년 11월 15일
연구 완료 (실제)
2022년 1월 1일
연구 등록 날짜
최초 제출
2022년 2월 23일
QC 기준을 충족하는 최초 제출
2022년 3월 4일
처음 게시됨 (실제)
2022년 3월 8일
연구 기록 업데이트
마지막 업데이트 게시됨 (실제)
2022년 4월 15일
QC 기준을 충족하는 마지막 업데이트 제출
2022년 4월 8일
마지막으로 확인됨
2022년 2월 1일
추가 정보
이 연구와 관련된 용어
개별 참가자 데이터(IPD) 계획
개별 참가자 데이터(IPD)를 공유할 계획입니까?
아니요
IPD 계획 설명
Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation.
It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis.
Hence, we hypothesis GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
약물 및 장치 정보, 연구 문서
미국 FDA 규제 의약품 연구
아니
미국 FDA 규제 기기 제품 연구
아니
이 정보는 변경 없이 clinicaltrials.gov 웹사이트에서 직접 가져온 것입니다. 귀하의 연구 세부 정보를 변경, 제거 또는 업데이트하도록 요청하는 경우 register@clinicaltrials.gov. 문의하십시오. 변경 사항이 clinicaltrials.gov에 구현되는 즉시 저희 웹사이트에도 자동으로 업데이트됩니다. .
SLC7A11, GPX4, P53에 대한 임상 시험
-
Shenzhen SiBiono GeneTech Co.,Ltd알려지지 않은
-
National Cancer Institute (NCI)완전한
-
Shenzhen SiBiono GeneTech Co.,Ltd알려지지 않은
-
National Cancer Institute (NCI)완전한
-
University of Texas Southwestern Medical CenterNational Cancer Institute (NCI)완전한
-
Aventis Pharmaceuticals알려지지 않은
-
Eastern Cooperative Oncology GroupNational Cancer Institute (NCI)완전한