Cette page a été traduite automatiquement et l'exactitude de la traduction n'est pas garantie. Veuillez vous référer au version anglaise pour un texte source.

Association Between Ferroptosis and Epilepsy

8 avril 2022 mis à jour par: Affiliated Hospital of Jiangnan University

Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children

Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.

Aperçu de l'étude

Statut

Complété

Les conditions

Intervention / Traitement

Description détaillée

To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy. Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues. Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children. Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls. Three glutathione peroxidase 4 (GPX4)dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11(SLC7A11), GPX4, tumor protein 53 (P53). Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.

Type d'étude

Observationnel

Inscription (Réel)

40

Contacts et emplacements

Cette section fournit les coordonnées de ceux qui mènent l'étude et des informations sur le lieu où cette étude est menée.

Lieux d'étude

    • Jiangsu
      • Wuxi, Jiangsu, Chine, 226600
        • Affiliated Hospital of JiangNan University, Department of Pediatrics

Critères de participation

Les chercheurs recherchent des personnes qui correspondent à une certaine description, appelée critères d'éligibilité. Certains exemples de ces critères sont l'état de santé général d'une personne ou des traitements antérieurs.

Critère d'éligibilité

Âges éligibles pour étudier

6 ans à 12 ans (Enfant)

Accepte les volontaires sains

Oui

Sexes éligibles pour l'étude

Tout

Méthode d'échantillonnage

Échantillon non probabiliste

Population étudiée

school-aged children who admitted to our hospital from Jan 20, 2021 to Jan 1, 2022

La description

Seizure group

Inclusion Criteria:

  1. Aged between 6 and 12 years old
  2. Newly diagnosed untreated epilepsy

Exclusion Criteria:

  1. Treated with medicine or another therapy
  2. Had history of cancer diseases
  3. Had history of endocrine diseases

Healthy control group

Inclusion Criteria:

1. Aged between 6 and 12 years old

Exclusion Criteria:

  1. Had history of epilepsy
  2. Had history of cancer diseases
  3. Had history of endocrine diseases

Plan d'étude

Cette section fournit des détails sur le plan d'étude, y compris la façon dont l'étude est conçue et ce que l'étude mesure.

Comment l'étude est-elle conçue ?

Détails de conception

Cohortes et interventions

Groupe / Cohorte
Intervention / Traitement
Seizures group
20 newly diagnosed untreated school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups
Healthy control group
20 age-matched healthy school-aged children from Jan 20, 2021 to Jan 1, 2022 in affiliated Hospital of Jiangnan University, department of pediatrics.
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups

Que mesure l'étude ?

Principaux critères de jugement

Mesure des résultats
Description de la mesure
Délai
Rt-qPCR
Délai: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.

Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow:

GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC

Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.

Mesures de résultats secondaires

Mesure des résultats
Description de la mesure
Délai
Western blot
Délai: Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
Western blotting is an important technique used in cell and molecular biology. Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53.
Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.

Collaborateurs et enquêteurs

C'est ici que vous trouverez les personnes et les organisations impliquées dans cette étude.

Les enquêteurs

  • Directeur d'études: YueYing Liu, Affiliated Hospital of JiangNan University, Department of Pediatrics

Dates d'enregistrement des études

Ces dates suivent la progression des dossiers d'étude et des soumissions de résultats sommaires à ClinicalTrials.gov. Les dossiers d'étude et les résultats rapportés sont examinés par la Bibliothèque nationale de médecine (NLM) pour s'assurer qu'ils répondent à des normes de contrôle de qualité spécifiques avant d'être publiés sur le site Web public.

Dates principales de l'étude

Début de l'étude (Réel)

20 janvier 2021

Achèvement primaire (Réel)

15 novembre 2021

Achèvement de l'étude (Réel)

1 janvier 2022

Dates d'inscription aux études

Première soumission

23 février 2022

Première soumission répondant aux critères de contrôle qualité

4 mars 2022

Première publication (Réel)

8 mars 2022

Mises à jour des dossiers d'étude

Dernière mise à jour publiée (Réel)

15 avril 2022

Dernière mise à jour soumise répondant aux critères de contrôle qualité

8 avril 2022

Dernière vérification

1 février 2022

Plus d'information

Termes liés à cette étude

Autres numéros d'identification d'étude

  • 2022/2/21

Plan pour les données individuelles des participants (IPD)

Prévoyez-vous de partager les données individuelles des participants (DPI) ?

NON

Description du régime IPD

Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, we hypothesis GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.

Informations sur les médicaments et les dispositifs, documents d'étude

Étudie un produit pharmaceutique réglementé par la FDA américaine

Non

Étudie un produit d'appareil réglementé par la FDA américaine

Non

Ces informations ont été extraites directement du site Web clinicaltrials.gov sans aucune modification. Si vous avez des demandes de modification, de suppression ou de mise à jour des détails de votre étude, veuillez contacter register@clinicaltrials.gov. Dès qu'un changement est mis en œuvre sur clinicaltrials.gov, il sera également mis à jour automatiquement sur notre site Web .

Essais cliniques sur SLC7A11, GPX4, P53

3
S'abonner