Gut Microbiota Dysbiosis in Lupus Nephritis

January 20, 2024 updated by: Hager Zanaty
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.

Study Overview

Status

Not yet recruiting

Detailed Description

Systemic Lupus Erythematosus (SLE) is an autoimmune disease resulting in multi-organ inflammation with complex clinical manifestation including neuropsychiatric, lupus nephritis..etc. However, the actual cause of SLE is still unknown [1].

Various etiologies have been postulated which can be categorized into genetic and environmental such as age, gender, ultra-violet exposure, dietary intake, alcohol, and lifestyle behavior [2].

Lupus nephritis is one of the most severe manifestations of SLE with high mortality rate and 10% of them eventually develop end-stage renal disease within 5 years after diagnosis [3,4].

There are trillion of microbes inhabited human gut which dominated by 4 phyla; Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria. In healthy human gut, 98% of gut microbiota is dominated by Bacteroidetes and Firmicutes. Every species of gut microbiota play their own role in modulating immune system. Many factors could alter gut communities such as infant transition, dietary habit, age, gender and antibiotic consumption [5, 6].

Firmicutes responsive in fatty acids and carbohydrates absorption whereas Bacteroidetes correspond to polysaccharides absorption [7].

Recently, enormous reports highlighted on the association of autoimmune diseases with dysbiosis of gut microbiota [8-11], During the autoimmune disease condition, the symbiotic relationship is broken due to various factor such as dietary habit that change microbiota diversity. The decrease of microbial diversity was found in autoimmune diseases such as SLE and inflammatory bowel disease (IBD), presented by reduce commensal bacteria (Firmicutes and Bacteroidetes) and increase of detrimental bacteria (Proteobacteria and Actinobacteria) [12].

Alteration of gut microbiota expresses as Firmicutes/Bacteroidetes ratio (F/B) potentially act as the measurement for pathological condition in SLE patients which cause systemic inflammation. The decreased ratio of F/B microbiome in SLE patients occur either by the reduction in Firmicutes or increase abundance of Bacteroidetes [13]. In human study, altered short chain fatty acids (SCFA) fecal level in lupus patient with low F/B ratio suggest the potential link of gut absorption function with microbes [14].

Hence, it is necessary to identify the exact mechanism on how the gut microbiota promote SLE and LN pathogenesis in human studies.

Study Type

Observational

Enrollment (Estimated)

60

Contacts and Locations

This section provides the contact details for those conducting the study, and information on where this study is being conducted.

Study Contact

Study Contact Backup

  • Name: Rasha Madkour, Lecturer
  • Phone Number: 01090895666

Participation Criteria

Researchers look for people who fit a certain description, called eligibility criteria. Some examples of these criteria are a person's general health condition or prior treatments.

Eligibility Criteria

Ages Eligible for Study

  • Adult

Accepts Healthy Volunteers

N/A

Sampling Method

Probability Sample

Study Population

Female patients at the of child bearing period

Description

Inclusion Criteria:

  • Adult male and female patients diagnosed with lupus nephritis. Adult age and sex matched healthy individuals will be included as a control group.

Informed consent will be obtained from each study participant.

Exclusion Criteria:

  • Subjects at age<18 years. Diseases affecting the gut microbiota (e.g. chronic diarrhea, Crohn's disease, or ulcerative colitis).

Patients on maintenance dialysis, with diabetes or pregnancy, using antibiotics, probiotics, prebiotics, or synbiotics in the previous 4 weeks.

Patients with critical condition (hypertension emergency,urgency, acute myocardial infarction or stroke within the last 6 months) and suspected/confirmed renal vascular disease.

Study Plan

This section provides details of the study plan, including how the study is designed and what the study is measuring.

How is the study designed?

Design Details

Cohorts and Interventions

Group / Cohort
Intervention / Treatment
Patient with lupus nepheritis

Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer.

The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows:

Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s.

Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR.

Healthy persons of the same age

Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer.

The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows:

Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s.

Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR.

What is the study measuring?

Primary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.
Time Frame: 2 years
Evaluate the relation of dysbiosis of some intestinal microbiota to the stage of lupus nephritis.
2 years

Collaborators and Investigators

This is where you will find people and organizations involved with this study.

Sponsor

Publications and helpful links

The person responsible for entering information about the study voluntarily provides these publications. These may be about anything related to the study.

Study record dates

These dates track the progress of study record and summary results submissions to ClinicalTrials.gov. Study records and reported results are reviewed by the National Library of Medicine (NLM) to make sure they meet specific quality control standards before being posted on the public website.

Study Major Dates

Study Start (Estimated)

January 1, 2025

Primary Completion (Estimated)

June 1, 2026

Study Completion (Estimated)

December 1, 2026

Study Registration Dates

First Submitted

January 20, 2024

First Submitted That Met QC Criteria

January 20, 2024

First Posted (Actual)

January 30, 2024

Study Record Updates

Last Update Posted (Actual)

January 30, 2024

Last Update Submitted That Met QC Criteria

January 20, 2024

Last Verified

January 1, 2024

More Information

Terms related to this study

Plan for Individual participant data (IPD)

Plan to Share Individual Participant Data (IPD)?

NO

Drug and device information, study documents

Studies a U.S. FDA-regulated drug product

No

Studies a U.S. FDA-regulated device product

No

This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.

Subscribe