- ICH GCP
- US Clinical Trials Registry
- Clinical Trial NCT03556176
The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise
The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise.
Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. In recent years, a growing number of studies have evaluated the association between these polymorphisms and personality traits related to anxiety and depression. Objectives: To determine the frequencies of 5-HTTLPR and BDNF polymorphisms in a college students population; To determine the influence of 5-HTTLPR and BDNF polymorphisms on mood states and anxiety after acute physical exercise. Material and Methods: Four hundred (400) College students will be assessed.
In the first phase of the study, the following procedures will be performed: Screening, Aerobic Fitness Assessment (Step Test), Questionnaires (PAR-Q, Habitual Physical Activity Level, Beck Anxiety and Depression Scale, State-Trait Anxiety, and Perceived Stress Scale), blood sample collection and genotyping. In the second phase of the study, two (2) groups with or without polymorphisms will be selected (for each gene). These groups will be submitted to four conditions (three experimental conditions and one control condition), carried out randomly and separated by an interval of 1 week. In the experimental Conditions the volunteers will perform treadmill exercises sessions (30 minutes) in three different intensities (light, moderate and vigorous) and will respond to the Borg Scale at 10, 20 e 30 minutes. In the control condition the volunteers will be instructed to remain seated (quiet rest), relaxed and silent for 30 minutes. In both conditions, the volunteers will complete the Profile of Mood States (POMS) and State-Anxiety (STAY), 05 (five) minutes before and, 5 (five) and 20 (twenty) minutes following the interventions.
Study Overview
Status
Conditions
Intervention / Treatment
Study Type
Enrollment (Actual)
Phase
- Not Applicable
Contacts and Locations
Study Locations
-
-
Goiás
-
Jataí, Goiás, Brazil, 75800-000
- UFG
-
-
Participation Criteria
Eligibility Criteria
Ages Eligible for Study
Accepts Healthy Volunteers
Genders Eligible for Study
Description
Inclusion criteria:
- 18-30 years of age;
- able to perform physical activities;
Non-inclusion criteria:
- history of cardiovascular or respiratory diseases;
- smoking;
- use of psychiatric drugs;
- psychotherapy treatment in the last six months.
Study Plan
How is the study designed?
Design Details
- Primary Purpose: Screening
- Allocation: Non-Randomized
- Interventional Model: Parallel Assignment
- Masking: None (Open Label)
Arms and Interventions
Participant Group / Arm |
Intervention / Treatment |
|---|---|
|
Active Comparator: 5-HTTLPR or BDNF polymorphisms
|
Three exercises sessions - 30 min (light: 45 - 50%, moderate: 65 -70% and vigorous: 85 - 90% Heart Rate Maximal).
Quiet rest during 30 min
|
|
Active Comparator: Control ( without 5-HTTLPR or BDNF polymorphisms )
|
Three exercises sessions - 30 min (light: 45 - 50%, moderate: 65 -70% and vigorous: 85 - 90% Heart Rate Maximal).
Quiet rest during 30 min
|
What is the study measuring?
Primary Outcome Measures
Outcome Measure |
Measure Description |
Time Frame |
|---|---|---|
|
Response of mood states after interventions
Time Frame: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest
|
The POMS questionnaire is an instrument to evaluate mood states.
It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment.
The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales.
The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor.
|
Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest
|
|
Response of anxiety after interventions
Time Frame: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest
|
Anxiety Inventory-STAI trait-state.
The scales encompasses 20 items and provides a one-dimensional measurement of anxiety.
Range of scores for each subtest is 20-80, the higher score indicating greater anxiety.
A cut point of 39-40 has been suggested to detect clinically significant symptoms.
|
Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest
|
Secondary Outcome Measures
Outcome Measure |
Measure Description |
Time Frame |
|---|---|---|
|
Evaluation safety or possible risk of exercising
Time Frame: baseline
|
The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity.
It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity.
Those who to answer no to all questions will be included in the protocol study.
|
baseline
|
|
Habitual Physical Activity Level
Time Frame: Baseline
|
Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity.
The questionnaire includes items about household activities, sport, and leisure time activities over the past year.
The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.
|
Baseline
|
|
Evaluation of depression and anxiety symptoms
Time Frame: Baseline
|
Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety. |
Baseline
|
|
Estimation the aerobic capacity
Time Frame: Baseline
|
McArdle Step Test was developed to estimate the aerobic capacity of university students.
For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective
|
Baseline
|
|
Detection of the polymorphism in the SLC6A4
Time Frame: Baseline
|
The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC). |
Baseline
|
|
Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A)
Time Frame: Baseline
|
The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis. |
Baseline
|
Collaborators and Investigators
Sponsor
Study record dates
Study Major Dates
Study Start (Actual)
Primary Completion (Actual)
Study Completion (Actual)
Study Registration Dates
First Submitted
First Submitted That Met QC Criteria
First Posted (Actual)
Study Record Updates
Last Update Posted (Actual)
Last Update Submitted That Met QC Criteria
Last Verified
More Information
Terms related to this study
Keywords
Additional Relevant MeSH Terms
Other Study ID Numbers
- 2.331.601
Plan for Individual participant data (IPD)
Plan to Share Individual Participant Data (IPD)?
Drug and device information, study documents
Studies a U.S. FDA-regulated drug product
Studies a U.S. FDA-regulated device product
This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.
Clinical Trials on Exercise
-
Centre Hospitalier de CorbieRecruitingExercise Training | Cardiac Rehabilitation | Exercise Intolerance | Exercise Intervention | Exercise Adaptations | HFrEF - Heart Failure With Reduced Ejection FractionFrance
-
Bitlis Eren UniversityCompletedExercise Physiology | Exercise ImmunologyTurkey (Türkiye)
-
Lindenwood UniversityIncrenovo, LLCRecruitingCognitive Function | Blood Flow | Nitric Oxide | Endurance Exercise | Exercise Performance | Exercise RecoveryUnited States
-
Hamza KucukCompletedExercise Training | Exercise PhysiologyTurkey (Türkiye)
-
Faculdade de Motricidade HumanaCompletedGreen Exercise | Indoor ExercisePortugal
-
Egas Moniz - Cooperativa de Ensino Superior, CRLCompletedAgeing | Aerobic Exercise | Resistance Exercise | Combined ExercisePortugal
-
Universidad Rey Juan CarlosCompletedEndurance Exercise | Running Performance | Exercise PhysiologySpain
-
Istanbul Sabahattin Zaim UniversityT.C. Dumlupınar ÜniversitesiCompletedExercise Ergogenics | Recovery Methods | Carnitine Ingestion | Exercise Fatigue | Exercise and RecoveryTurkey (Türkiye)
-
Hasan Kalyoncu UniversityNot yet recruiting
-
University of HawaiiKlein Buendel, Inc.CompletedMomZing Exercise Videos Online | Standard Exercise DVDUnited States
Clinical Trials on Exercise
-
National Institute of Neurological Disorders and...TerminatedTraumatic Brain InjuryUnited States
-
University of Texas, El PasoRecruitingKnee Osteoarthritis | Knee Pain Chronic | Central Pain SyndromeUnited States
-
Aksaray University Training and Research HospitalCompletedExercise Training | Lactate Blood Increase | Cognitive Functions | BDNFTurkey (Türkiye)
-
Toronto Rehabilitation InstituteCompletedAcute Myeloid LeukemiaCanada
-
University College CorkRecruitingDepressive Disorder, MajorIreland
-
Sahmyook UniversityRecruitingChronic Nonspecific Neck PainKorea, Republic of
-
Uskudar UniversityCompleted
-
Yuksek Ihtisas UniversityCompletedDementia | Frailty | Cognitive Function | Reaction Time | Aerobic Exercise | Balance ExerciseTurkey
-
National Taiwan Normal UniversityCompletedAging | Cognitive DeclineTaiwan
-
Wayne State UniversityUnknown