Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis

February 5, 2026 updated by: Salma Khalaf Abdelmageed, Sohag University

Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs.

The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.

Study Overview

Status

Not yet recruiting

Conditions

Detailed Description

Although the aetiology and progression of RA remain incompletely elucidated, various therapeutic modalities are accessible, significantly altering the prognosis of patients with the disease.

Various cell types are implicated in the pathophysiology of RA, including synovial fibroblasts, osteoclasts, immune associated T and B lymphocytes, and macrophages. The orchestration of these cells induces the release of diverse inflammatory mediators (cytokines and chemokines) that perpetuate the chronic inflammatory response of the disease. Chemokines and their receptors regulate lymphocyte recruitment to inflamed joints in RA. Cytokines, encompassing both pro inflammatory and anti-inflammatory types, are recognized for their essential involvement in the evolution of RA via inflammation and the degradation of articular cartilage.

The chemokine receptor (CCR)6 is a class A GPCR within the chemokine family, noted for its notable therapeutic promise in immunological research.

The sole chemokine ligand for CCR6 is chemokine ligand 20 (CCL20), which is also referred to as macrophage inflammatory protein (MIP) 3α, Exodus 1 and liver and activation regulated chemokine. In humans, it is expressed by neutrophils, Th17 cells and peripheral blood mononuclear cells. This axis has distinct functions in immunological homeostasis and activation.

CCL20 is one of the chemokines mainly produced by inflamed synovial cells in response to cytokines, including TNF-α (tumour necrosis factor-α), IL-1, IL-17, and IL-18.

Synovial T lymphocytes generate cytokines, such as TNFα, IFNγ and IL 17A. The production of pro inflammatory cytokines was originally ascribed to Th1 cells Subsequently, it was elucidated that IL 17A production among Th cells was confined to a distinct Th cell subpopulation, subsequently designated as Th17.

The interaction between CCR6 and CCL20 is critical, not only for the migration of Th17 cells, but also for their activation and differentiation. CCL20 has been shown to be involved in the differentiation of naive T cells into Th17 cells, thereby directly influencing IL 17A production in patients with RA.

Study Type

Observational

Enrollment (Estimated)

60

Contacts and Locations

This section provides the contact details for those conducting the study, and information on where this study is being conducted.

Study Contact

Participation Criteria

Researchers look for people who fit a certain description, called eligibility criteria. Some examples of these criteria are a person's general health condition or prior treatments.

Eligibility Criteria

Ages Eligible for Study

  • Adult

Accepts Healthy Volunteers

Yes

Sampling Method

Probability Sample

Study Population

Patients with Rheumatoid Arthritis aged from 18 years to 60 years, in Rheumatology and Rehabilitation department of Sohag University Hospital and healthy controls of matched age and sex

Description

Inclusion Criteria:

  • Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.

Exclusion Criteria:

  • • Patients with co-existing infections or other autoimmune diseases.

Study Plan

This section provides details of the study plan, including how the study is designed and what the study is measuring.

How is the study designed?

Design Details

Cohorts and Interventions

Group / Cohort
Intervention / Treatment
Group II
apparently healthy controls with no chronic illness of matched age and sex

Sample collection:

  • 5 ml peripheral blood will be collected under sterile conditions.

    1-Gene Expression Assay

  • Total RNA Extraction
  • cDNA Synthesis
  • Gene Expression Analysis:

    o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC

  • Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level
  • Using Enzyme Linked Immunosorbent Assay kit (ELISA).
Group I
Patients with Rheumatoid Arthritis

Sample collection:

  • 5 ml peripheral blood will be collected under sterile conditions.

    1-Gene Expression Assay

  • Total RNA Extraction
  • cDNA Synthesis
  • Gene Expression Analysis:

    o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC

  • Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level
  • Using Enzyme Linked Immunosorbent Assay kit (ELISA).

What is the study measuring?

Primary Outcome Measures

Outcome Measure
Measure Description
Time Frame
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals
Time Frame: within 3 days of samples collection
assessment of CCR6 gene expression level using quantitative real time PCR
within 3 days of samples collection

Secondary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Measure the plasma levels of CCL20
Time Frame: within 3 days after samples collection
Measurement of the plasma levels of CCL20 using enzyme-linked immunosorbent assay (ELISA)
within 3 days after samples collection

Collaborators and Investigators

This is where you will find people and organizations involved with this study.

Publications and helpful links

The person responsible for entering information about the study voluntarily provides these publications. These may be about anything related to the study.

General Publications

  • Conforti A, Di Cola I, Pavlych V, Ruscitti P, Berardicurti O, Ursini F, Giacomelli R and Cipriani P (2021): Beyond the joints, the extra-articular manifestations in rheumatoid arthritis. Autoimmun Rev 20: 102735.
  • 2- Ciofani M, Madar A, Galan C, Sellars M, Mace K, Pauli F, Agarwal A, Huang W, Parkhurst CN, Muratet M, et al (2012): A vali dated regulatory network for Th17 cell specification. Cell 151: 289-303.
  • 1- Al Obaidi MJ and Al Ghurabi BH: Potential role of NLRP3 inflammasome activation in the pathogenesis of periodontitis patients with type 2 diabetes mellitus. J Med Chem Sci 6: 522-531, 2023.

Study record dates

These dates track the progress of study record and summary results submissions to ClinicalTrials.gov. Study records and reported results are reviewed by the National Library of Medicine (NLM) to make sure they meet specific quality control standards before being posted on the public website.

Study Major Dates

Study Start (Estimated)

March 1, 2026

Primary Completion (Estimated)

February 1, 2027

Study Completion (Estimated)

March 1, 2027

Study Registration Dates

First Submitted

January 30, 2026

First Submitted That Met QC Criteria

February 5, 2026

First Posted (Actual)

February 9, 2026

Study Record Updates

Last Update Posted (Actual)

February 9, 2026

Last Update Submitted That Met QC Criteria

February 5, 2026

Last Verified

February 1, 2026

More Information

Terms related to this study

Other Study ID Numbers

  • Soh-Med-26-1-3MD

Drug and device information, study documents

Studies a U.S. FDA-regulated drug product

No

Studies a U.S. FDA-regulated device product

No

This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.

Clinical Trials on Rhematoid Arthritis

Clinical Trials on Gene expression by quantitative Real Time PCR

3
Subscribe