Telomere Length in Relation to Acute Stress Response in Critical Care Patients

the investigators studied the impact of severe stress (in this case any event or illness leading to a necessity of critical care) on telomere length.

Study Overview

• Status: Completed
• Conditions: Acute Disease; Telomere Shortening

Detailed Description

Telomeres length analysis were determined from 2 blood samples, the initial sample drawn in the first 72 hours after hospitalization and the second after not < 5 or > 14 days. For patients discharged before day 5, a repeat sample was drawn and analyzed on the discharge day. The blood sample processing was as follows: 5 ml of blood was collected and the red blood cells (RBC) were lysed using the RBC lysis solution (Biological Industries, Beit Haemek, Israel). Isolation of genomic DNA was performed by using the DNA isolation kit for mammalian blood (Roche, Mannheim, Germany). Briefly, DNA was isolated by the salting out procedure, washed and precipitated by isopropanol. The DNA was resuspended in polymerase chain reaction (PCR) grade water. The DNA concentration was measured by using the NanoDrop device (Thermo Fisher, USA).

DNA samples were analyzed for telomere length according to the method of Cawthon (2009) [20] with slight modifications. Each DNA sample was analyzed by two sets of primers detailed below, one for telomere length analysis and one for a reference gene analysis (human hemoglobin). The primers were diluted to 100µM in PCR grade water and then to 10µM. DNA samples were diluted to 2.5 ng/µl in PCR grade water. The primers sequences are shown below:

telc: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT hbgd:_GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT hbgu: GGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG

Reaction PCR were processed as follows:

50°C for 2 min, 95°C for 5 min, a single cycle of 94°C for 15 sec, 49°C for 15 sec; 40 cycles of: 94°C for 15sec, 62°C for 10 sec and a final stage of: 74°C for 15 sec. All reactions were performed using the Step One device (ABI, USA).

• Study Type: Observational
• Enrollment (Actual): 40

Contacts and Locations

Study Locations

• Israel
  • Petah Tikva, Israel
    • Rabin Medical Center

Participation Criteria

Eligibility Criteria

• Ages Eligible for Study: 18 years to 75 years (Adult, Older Adult)
• Accepts Healthy Volunteers: No
• Genders Eligible for Study: All

• Sampling Method: Non-Probability Sample

Study Population

adults (male and females) admitted to the ICU

Description

Inclusion Criteria:

• • Patients hospitalized up to 72 hours prior to admission to the ICU

  • Predicted ICU stay is at least 5 days

Exclusion Criteria:

• • Pregnancy and lactation

Study Plan

How is the study designed?

What is the study measuring?

Primary Outcome Measures

Outcome Measure	Measure Description	Time Frame
telomere length difference	the difference between telomere length in percent between samples taken	7 days

Secondary Outcome Measures

Outcome Measure	Measure Description	Time Frame
correlation between mortality and telomere length	correlation between mortality and telomere length	6 month
correlation between telomere length change and leukocytes count change	correlation between telomere length change and leukocytes count change	7 days

Collaborators and Investigators

• Sponsor: Rabin Medical Center

Study record dates

Study Major Dates

• Study Start (Actual): October 1, 2017
• Primary Completion (Actual): March 30, 2018
• Study Completion (Actual): September 30, 2018

Study Registration Dates

• First Submitted: June 10, 2019
• First Submitted That Met QC Criteria: June 10, 2019
• First Posted (Actual): June 11, 2019

Study Record Updates

• Last Update Posted (Actual): June 25, 2019
• Last Update Submitted That Met QC Criteria: June 23, 2019
• Last Verified: June 1, 2019

More Information

Terms related to this study

• Additional Relevant MeSH Terms: Pathologic Processes; Disease Attributes; Acute Disease
• Other Study ID Numbers: 0319-11-RMC

Drug and device information, study documents

• Studies a U.S. FDA-regulated drug product: No
• Studies a U.S. FDA-regulated device product: No