Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction

December 3, 2023 updated by: Karaganda Medical University

Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.

Today there are several methods for detecting BT:

  1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
  2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).

The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.

Study Overview

Status

Active, not recruiting

Conditions

Intervention / Treatment

Detailed Description

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.

The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.

The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).

During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.

This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).

Study Type

Observational

Enrollment (Estimated)

150

Contacts and Locations

This section provides the contact details for those conducting the study, and information on where this study is being conducted.

Study Contact

Study Contact Backup

  • Name: Yemek Turgunov, Pr.
  • Phone Number: +77016119655
  • Email: Turgunov@qmu.kz

Study Locations

  • Kazakhstan
      • Karaganda, Kazakhstan, 100000
        • NJSC Karaganda Medical University

Participation Criteria

Researchers look for people who fit a certain description, called eligibility criteria. Some examples of these criteria are a person's general health condition or prior treatments.

Eligibility Criteria

Ages Eligible for Study

18 years and older (Adult, Older Adult)

Accepts Healthy Volunteers

No

Sampling Method

Probability Sample

Study Population

Patients with malignant and benign acute bowel obstruction, colorectal cancer patients without acute bowel obstruction (planned operations) aged from 18, who are expected to undergo surgical treatment for this pathology.

Description

Inclusion Criteria:

  • patients with malignant acute bowel obstruction,
  • patients with benign acute bowel obstruction,
  • colorectal cancer patients without acute bowel obstruction (planned operations).

Exclusion Criteria:

  • age less than 18,
  • pregnancy,
  • patients with paralytic acute bowel obstruction,
  • patients with HIV infection, liver cirrhosis,
  • patient with an infectious process due to another pathology.

Study Plan

This section provides details of the study plan, including how the study is designed and what the study is measuring.

How is the study designed?

Design Details

Cohorts and Interventions

Group / Cohort
Intervention / Treatment
Malignant ABO
60 patients with malignant acute bowel obstruction
Diagnostic test: LBP
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Diagnostic test: sCD14-ST
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Diagnostic test: 16s rRNA
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.
CRC without ABO (control)
60 colorectal cancer patients without acute bowel obstruction (planned operations)
Diagnostic test: LBP
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Diagnostic test: sCD14-ST
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Diagnostic test: 16s rRNA
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.
Benign ABO
30 patients with benign acute bowel obstruction
Diagnostic test: LBP
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Diagnostic test: sCD14-ST
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Diagnostic test: 16s rRNA
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.

What is the study measuring?

Primary Outcome Measures

Outcome Measure
Measure Description
Time Frame
Change in number of Participants with Post-operative infectious and inflammatory complications
Time Frame: day 3, day 7, day 10
Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)
day 3, day 7, day 10

Secondary Outcome Measures

Outcome Measure
Measure Description
Time Frame
LBP level in serum blood
Time Frame: 1 hour before surgery, 24 hours after surgery, 72 hours after surgery
LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
1 hour before surgery, 24 hours after surgery, 72 hours after surgery
sCD14-ST level in serum blood
Time Frame: 1 hour before surgery, 24 hours after surgery, 72 hours after surgery
sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
1 hour before surgery, 24 hours after surgery, 72 hours after surgery
16s rRNA in mesenteric lymph nodes
Time Frame: Once (MLN sampling in sterile conditions during surgery)
Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.
Once (MLN sampling in sterile conditions during surgery)

Collaborators and Investigators

This is where you will find people and organizations involved with this study.

Sponsor

Karaganda Medical University

Collaborators

Ministry of Education and Science, Republic of Kazakhstan

Investigators

  • Study Chair: Yemek Turgunov, Pr., NJSC Karaganda Medical University
  • Principal Investigator: Alina Ogizbayeva, PhD student, NJSC Karaganda Medical University
  • Principal Investigator: Lyudmila Akhmaltdinova, PhD, NJSC Karaganda Medical University
  • Principal Investigator: Kairat Shakeyev, Pr., NJSC Karaganda Medical University
  • Principal Investigator: Dmitry Matyushko, PhD, Multidisciplinary hospital No. 1 of Karaganda
  • Principal Investigator: Miras Mugazov, PhD, NJSC Karaganda Medical University
  • Principal Investigator: Asylbek Zhumakaev, Master, Multidisciplinary hospital No. 3 of Karaganda
  • Principal Investigator: Irina Kadyrova, PhD, NJSC Karaganda Medical University

Publications and helpful links

The person responsible for entering information about the study voluntarily provides these publications. These may be about anything related to the study.

General Publications

Helpful Links

Study record dates

These dates track the progress of study record and summary results submissions to ClinicalTrials.gov. Study records and reported results are reviewed by the National Library of Medicine (NLM) to make sure they meet specific quality control standards before being posted on the public website.

Study Major Dates

Study Start (Actual)

March 1, 2021

Primary Completion (Actual)

October 31, 2023

Study Completion (Estimated)

December 31, 2023

Study Registration Dates

First Submitted

January 21, 2022

First Submitted That Met QC Criteria

February 3, 2022

First Posted (Actual)

February 8, 2022

Study Record Updates

Last Update Posted (Estimated)

December 5, 2023

Last Update Submitted That Met QC Criteria

December 3, 2023

Last Verified

October 1, 2023

More Information

Terms related to this study

Keywords

Additional Relevant MeSH Terms

Other Study ID Numbers

  • BT-ABO

Plan for Individual participant data (IPD)

Plan to Share Individual Participant Data (IPD)?

NO

Drug and device information, study documents

Studies a U.S. FDA-regulated drug product

No

Studies a U.S. FDA-regulated device product

No

This information was retrieved directly from the website clinicaltrials.gov without any changes. If you have any requests to change, remove or update your study details, please contact register@clinicaltrials.gov. As soon as a change is implemented on clinicaltrials.gov, this will be updated automatically on our website as well.

Clinical Trials on Systemic Inflammatory Response Syndrome

Clinical Trials on LBP

Search Similar Trials

Sponsors and Collaborators

Medical Conditions

Drug Interventions

CROs by country

CROs in Madagascar

Conditions

Rare Diseases

Drug Interventions

Dietary Supplements

Sponsor/Collaborators

Locations

3
Subscribe